EST details — SGN-E398084

Search information 
Request: 398084Match: SGN-E398084
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183681Clone name: TUS-42-M23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183681 is on microarray TOM1 spot ID 1-1-2.1.1.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80683 [cLET-13-B24] Trace: SGN-T106001 EST: SGN-E294158 Direction: 5' Facility: TIGR
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195502 EST: SGN-E394176 Direction: 3' Facility: INRA
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195970 EST: SGN-E394644 Direction: 3' Facility: INRA
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195971 EST: SGN-E394645 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398084Length: 587 bp (814 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398084 [] (trimmed) GTGGAGCTAGGTAGGACCTTAGACCTGGCAGAATGTGCTTTGTGGATGCCATGCCAAGGAGGCCTGACTTTGCAACTTTCCCATAATTTAAACAA
TCTAATACCTCTGGGATCTACTGTGCCAATTAATCTTCCTATTATCAATGAAATTTTTAGTAGCCCTGAAGCAATACAAATTCCACATACAAATC
CTTTGGCAAGGATGAGGAATACTGTTGGTAGATATATTCCACCAGAAGTAGTTGCTGTTCGTGTACCGCTTTTACACCTCTCAAATTTTACTAAT
GACTGGGCTGAACTGTCTACTAGAAGTTATGCGGTTATGGTTCTGGTTCTCCCGATGAATGGCTTAAGAAAGTGGCGTGAACATGAGTTAGAACT
TGTGCAAGTTGTCGCAGATCAGGTTGCTGTCGCTCTTTCACATGCTGCAATTTTAGAAGATTCCATGCGAGCCCATGATCAGCTCATGGAACAAA
ATATTGCTTTGGATGTAGCTCGACAAGAAGCAGAGATGGCCATCCGTGCACGTAACGACTTCCTTGCTGTGATGAACCATTGAAATGAAAACGCC
CATGCATGCAGTTATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398084] SGN-U580538 Tomato 200607 Build 2 122 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199410 [Download][View] Facility Assigned ID: FA0AAD30AG12RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5