EST details — SGN-E398408

Search information 
Request: 398408Match: SGN-E398408
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183228Clone name: TUS-41-K2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183228 is on microarray TOM1 spot ID 1-1-7.3.3.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C109840 [cLPT-1-D3] Trace: SGN-T177683 EST: SGN-E366258 Direction: 5' Facility: TIGR
Clone: SGN-C183228 [TUS-41-K2] Trace: SGN-T199474 EST: SGN-E398148 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398408Length: 497 bp (838 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398408 [] (trimmed) CAGCCTGCTTCTGCGCCTAACTGCAGAATACACCGCTTTTCGGCAGGAGAGCAATTCCCCCTACGAACAAAGTCATCATGCCTGCACTTGTTGTA
ACGGAAGAAACAATGGCCTCCGAGCTATCCAAGAAAAAAATGAAAAAGACACCCAAAACTGATATTGAAACTCCTACTGATAAGAAAACCAAAGA
GAAAAAGTCAAAAAAATCCAAGATTGAGTCTGGGTCTGATTCAGAGGACGCTAAAAGGAGTAAAAAAAAAAAAAAAAAAACTCGAGCTGCTTACC
AGCGAAAATCAACCTCTGCTGGTCTGAAGGAATTCCCTCCTTGTCCTGGATCTTAGCCTTAACATTATCAATGGTGTCGGAGCTTTCCACCTCCA
AAGTGATGGTCTTTCCGGTGAGGGTCTTAACAAAAATCTGCATACCACCACGGAGACGGAGGACAAGATGGAGGGTAGACTCCTTCTGGATGTTG
TAGTCAGCCAGGGTGCGACCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398408] SGN-U577265 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199734 [Download][View] Facility Assigned ID: FA0AAD29BF01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0066 Quality Trim Threshold: 12.5