EST details — SGN-E398511

Search information 
Request: 398511Match: SGN-E398511
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174513Clone name: TUS-18-O23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174513 is on microarray TOM1 spot ID 1-1-2.3.15.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174513 [TUS-18-O23] Trace: SGN-T197137 EST: SGN-E395811 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398511Length: 582 bp (837 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398511 [] (trimmed) CAGGCCTTACCATCCTACACCCGTCTACAAGTCTCCACCACCACCAACTCCCGTCTACAAGTCACCACCACCACCAGTGAAGCCATACCATCCTA
CACCCGTCTACAAGTCTCCACCACCACCAACTCCCGTCTACAAGTCACCACCACCACCAGTGAAGCCATACCATCCTACACCCGTATACAAGTCT
CCACCACCACCAACTCCCGTTTACAAGTCACCACCACCACCAGTGAAGCCATATCATCCCTCACCAACACCATACCACCCTACACCAGCATACAA
GTCTCCACCACCACCAACTCCAGTCTACAAGTCTCCACCACCAACCCACTATGTTTACTCCTCTCCCCCTCCTCCCTACCATTACTAAGAAGTGA
GTTTACTATATCTGAGGAAAAGCATAATGTTGAGCGGAGGGAAAGGCATTTTCCATTTTCAAGAAGAAAATTATAGTAAATAATAAGGCTTACAG
AAGATCAGACGAAGTTCTTTTGTAGCTTCATGTTATCTAACTAGTCTTAGTGATATATTGTTTTTGTACTCTATTTTTATATATACTTTTATGTG
TCCTTGTGTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398511] SGN-U568616 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199837 [Download][View] Facility Assigned ID: FA0AAD6AH12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.896 Expected Error Rate: 0.0060 Quality Trim Threshold: 12.5