EST details — SGN-E398539

Search information 
Request: 398539Match: SGN-E398539
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174200Clone name: TUS-18-B22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174200 is on microarray TOM1 spot ID 1-1-3.2.16.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7252 [cLEC-38-F3] Trace: SGN-T31549 EST: SGN-E209014 Direction: 5' Facility: TIGR
Clone: SGN-C174200 [TUS-18-B22] Trace: SGN-T197308 EST: SGN-E395982 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398539Length: 581 bp (822 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398539 [] (trimmed) AAAAAAAACTCCAAAGCCCCAGGGGGTTATATAATGGACACAACCTTAAATTACTACCTTAAAACATCATTTTTCACATAACGAGTCCTTCCTAA
AGAGTCGGATCTTTAGATGTTACTATTTTCTCAAAGAGTTTAAGTTATATACACCGTTATTATAAACTTTTCTCAAATAGGACCAACCTATTATC
AGCTAGTCTAGTCTTGTAAGCTGACTTTTTGTACTCAAACCATGTAAACTCTTTGTATAAACTGTCTTTTCCTTCCATTAGTGATGGCAATGGTG
CTATCTTTTCACTCAATGGTGGTCCTCCAAAATATATCATTGATAGTCTTGATTTCACACTGTTTGTCAACACCCTATGTTTCACACTCTTAAAC
CTTCCATTCGTCATCACCTGTAATGAGTCTCCAACATTGACGAAAAAAGAATTCTGATCAGATGGAACAGAAAACCAGTTGCCATTTTTGAGTAA
AATTTGAAGACCGGAAGTGTTGTTGGATCTTAAAATCCACATGATTTGTGGATCAGTATGTTCTCCAAATCCAATTAAATTTTTGGCCTTGAATT
CTTTGAATATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398539] SGN-U578575 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199865 [Download][View] Facility Assigned ID: FA0AAD6DA11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0196 Quality Trim Threshold: 14.5