EST details — SGN-E398557

Search information 
Request: 398557Match: SGN-E398557
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174641Clone name: TUS-19-E7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174641 is on microarray TOM1 spot ID 1-1-2.1.15.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23345 [cLED-5-C19] Trace: SGN-T49745 EST: SGN-E231129 Direction: 5' Facility: TIGR
Clone: SGN-C174641 [TUS-19-E7] Trace: SGN-T197418 EST: SGN-E396092 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398557Length: 159 bp (970 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398557 [] (trimmed) TACGGTCCATTTGAGAAATTCACTCGATTGACTATGATCTTGCCCTTGACGGGTAAGCAAGACTCTTTGAAGGTAGCAGAAAATTGTGTTGCATA
TTGGAAAGCAATAGGAACCTACAGTGAGGCAGAGATGCAGGCCCTTGAGAAGTTCCTCGATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398557] SGN-U577427 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199883 [Download][View] Facility Assigned ID: FA0AAD7AC04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0187 Quality Trim Threshold: 20.5