EST details — SGN-E398557
| Search information |
| Request: 398557 | Match: SGN-E398557 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C174641 | Clone name: TUS-19-E7 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C174641 is on microarray TOM1 spot ID 1-1-2.1.15.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C23345 [cLED-5-C19] | Trace: SGN-T49745 | EST: SGN-E231129 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C174641 [TUS-19-E7] | Trace: SGN-T197418 | EST: SGN-E396092 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E398557 | Length: 159 bp (970 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E398557 [] (trimmed)
TACGGTCCATTTGAGAAATTCACTCGATTGACTATGATCTTGCCCTTGACGGGTAAGCAAGACTCTTTGAAGGTAGCAGAAAATTGTGTTGCATA
TTGGAAAGCAATAGGAACCTACAGTGAGGCAGAGATGCAGGCCCTTGAGAAGTTCCTCGATGTT
TTGGAAAGCAATAGGAACCTACAGTGAGGCAGAGATGCAGGCCCTTGAGAAGTTCCTCGATGTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398557] | SGN-U577427 | Tomato 200607 | Build 2 | 23 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199883 [Download][View] | Facility Assigned ID: FA0AAD7AC04FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.952 | Expected Error Rate: 0.0187 | Quality Trim Threshold: 20.5 |
Working
