EST details — SGN-E398587

Search information 
Request: 398587Match: SGN-E398587
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184052Clone name: TUS-43-M10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184052 is on microarray TOM1 spot ID 1-1-7.1.18.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3578 [cLEC-21-A7] Trace: SGN-T27986 EST: SGN-E205663 Direction: 5' Facility: TIGR
Clone: SGN-C184052 [TUS-43-M10] Trace: SGN-T197897 EST: SGN-E396571 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398587Length: 302 bp (872 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398587 [] (trimmed) AATTATCAAAATACACATATGGATAACTCATCGACTGATCTAAATAGAGCAATAGAAGGTTTAATTCGTGGTCGAGAATTTACTCGACGACTAAA
AGAGATTATTAAAAAATCTGGTGGTGAAGTTGAAAACATTATGGCTGAGGATTTAGTTGCCAAAATTCTGGATTCATTTTCTGAGACTCTCTCCG
TTATAAACAATTCTGATGTCGTCGTCGCTACGGCGGTTGAGGTCAAGTCGCCGGAAGATTATTCTAGTGGAAGTTGCAAGAGTGCATATCGAGGA
CGAGGCGACATGTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398587] SGN-U577934 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199913 [Download][View] Facility Assigned ID: FA0AAD31BG05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5