EST details — SGN-E398600

Search information 
Request: 398600Match: SGN-E398600
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184034Clone name: TUS-43-L16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184034 is on microarray TOM1 spot ID 1-1-1.4.18.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22932 [cLED-4-A21] Trace: SGN-T49374 EST: SGN-E231605 Direction: 5' Facility: TIGR
Clone: SGN-C184034 [TUS-43-L16] Trace: SGN-T198124 EST: SGN-E396798 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398600Length: 587 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398600 [] (trimmed) CCACAACCAAAATGGAGCACCTTGGTTATCATGGAAGAATCGGCTAAGAGTTGCTAGTGAGACAGCAAGTGCACTTGCTTACCTTCATTCATCCG
CCCAAATGCCAATAATTCATAGAGATGTCAAGTCTGCCAATTTATTGTTGGACGATGTTTACACAGCGAAAGTGGCAGATTTTGGAGCATCAAGA
TTAATCCCTCTTGATCAAACACATATTGCCACATTGGTTCAAGGAACATTAGGATACCTAGATCCTGAATATTTTCGTTTAAGTAAATTGACAGA
GAAAAGTGATGTTTATAGTTTTGGAGTAGTCCTTGCAGAACTTTTAACAGGTATAAAACCTATTTCGAGGGATAAGAATAACGAGGACAAGAATT
TGGCAGAGTGTTTCATTTTGTCCATGAGAAAGAATCAATTATATCAAATTCTTGATCGTAGAGTGGTAAAAGAAGGAAGCCTCGAACAACTCCAA
AAGGTGGCTGAGCTAGTGAAAAATTGTCTTAAATTGCACGGTGAACATAGGCCTACGATGAAGGAATTAGCAATGAAACTTGAAAGTTTGCGGAA
AGTTCCCAAAAAAATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398600] SGN-U583856 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199926 [Download][View] Facility Assigned ID: FA0AAD31DF08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5