EST details — SGN-E398688

Search information 
Request: 398688Match: SGN-E398688
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184819Clone name: TUS-45-M9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184819 is on microarray TOM1 spot ID 1-1-8.1.14.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81124 [cLET-14-J20] Trace: SGN-T106168 EST: SGN-E294325 Direction: 5' Facility: TIGR
Clone: SGN-C81124 [cLET-14-J20] Trace: SGN-T106169 EST: SGN-E294326 Direction: 3' Facility: TIGR
Clone: SGN-C184819 [TUS-45-M9] Trace: SGN-T198586 EST: SGN-E397260 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398688Length: 341 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398688 [] (trimmed) TAAGTTTGAGAAACGTCTAGTCTAGAGAGAAATGGCAAATCCAAAGGTTTTCTTTGACCTTACCATCGGTGGTGCACCAGCTGGTCGTGTGGTGA
TGGAGCTCTTCGCCGATACCACTCCCAAAACCGCTGAGAACTTCCGAGCTCTTTGTACCGGTGAGAAAGGTGTTGGAAAGATGGGGAAGCCTTTG
CACTACAAGGGCTCAACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCAAGGAGGTGATTTCACCGCCGGAAACGGGACCGGAGGAGAGTCGAT
CTATGGAGCCAAATTCAACGATGATATTTTCGTTAAGAAGCACACCGGCCCTGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398688] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200014 [Download][View] Facility Assigned ID: FA0AAD33AG05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0141 Quality Trim Threshold: 14.5