EST details — SGN-E398698

Search information 
Request: 398698Match: SGN-E398698
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184763Clone name: TUS-45-K1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184763 is on microarray TOM1 spot ID 1-1-8.3.14.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80190 [cLET-11-I12] Trace: SGN-T105311 EST: SGN-E292848 Direction: 5' Facility: TIGR
Clone: SGN-C184763 [TUS-45-K1] Trace: SGN-T200012 EST: SGN-E398686 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398698Length: 372 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398698 [] (trimmed) AATTGGAGTCTTAAGATTAAACATAAACCGCTTAAAAGCAACACAACAACCAATTACGGTTAACCCTAAAACTCGACCCGACACGACCCGACCAA
AGCAGTAAAGATAGTTTGAAATTAAAAACAAAGCCTAAAACGGCGACTCAAATACATAAAAGACTGATAAAACTAGATCATCATCATCATCAGAT
CTAGAGTTGACCGCAGTCAGCAATAACCACAGGCTTGGAGCACCTTCCAGAGCTAGATCCAACAGCCTCTGCCTTCTTAATCACATCCATGCCTT
CAACAACTTGTCCAAACACGACGTGCTTTCCGTTGAGCCACTCATTCTTAGCGGTACAGATGAAAAACTGAAAACCGTTGGTTCCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398698] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200024 [Download][View] Facility Assigned ID: FA0AAD33AF01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5