EST details — SGN-E398724
| Search information |
| Request: 398724 | Match: SGN-E398724 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C184835 | Clone name: TUS-45-N1 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184835 is on microarray TOM1 spot ID 1-1-8.2.14.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C87950 [cLET-6-H1] | Trace: SGN-T103844 | EST: SGN-E291591 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C184835 [TUS-45-N1] | Trace: SGN-T198736 | EST: SGN-E397410 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E398724 | Length: 171 bp (916 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E398724 [] (trimmed)
ACTTCAAACATAAATAAATTATACATAAATTTTTGTTTATCACCAATATAAAATATTCATAATACATTTATTTCACAAATTATGGAGGACAAGAA
ATTAAAGAAGGGACCTATATATGTTTGTTAAACTTGGAACACTTAAATTTCATCAACAATCCATGTGATCAAGGTC
ATTAAAGAAGGGACCTATATATGTTTGTTAAACTTGGAACACTTAAATTTCATCAACAATCCATGTGATCAAGGTC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398724] | SGN-U567597 | Tomato 200607 | Build 2 | 7 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T200050 [Download][View] | Facility Assigned ID: FA0AAD33CG01FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.820 | Expected Error Rate: 0.0048 | Quality Trim Threshold: 14.5 |
Working
