EST details — SGN-E398763

Search information 
Request: 398763Match: SGN-E398763
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185251Clone name: TUS-46-O9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185251 is on microarray TOM1 spot ID 1-1-8.3.12.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17117 [cLED-18-L13] Trace: SGN-T53147 EST: SGN-E237844 Direction: 5' Facility: TIGR
Clone: SGN-C185251 [TUS-46-O9] Trace: SGN-T198972 EST: SGN-E397646 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398763Length: 695 bp (866 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398763 [] (trimmed) CATTAATATATTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGAAAACAAGGGAAAATGAATACAATTTCTCA
AGGGAAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTAGTATCCTTCGGGCTTGTAAGCGA
TGAAACTGATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTGCCTCCTGCACCTCAGCC
AAGACCTGGGTTGCATCAGTGCACCCGAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGTGACTTATGGTTCTCACG
GTACACAAATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTCAATTTCGCTGAGCAATTGCTCGTCGGACA
AATCAGGAAGGTACGACAGAGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAACTGACTCTTCCACCGTTGCTAGCAATGGAG
GTAATGTCAAGGTTTTGCTTCCTTGAAACAGGGAAAGAAGCGGTGGACTTGAGTCCAGTGAAGGGTGCAACCATGCTAGCTTGTGCACCATTGCC
CCGGGTGGCAACACCTGCTGAGGACATTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398763] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200089 [Download][View] Facility Assigned ID: FA0AAD34AH05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5