EST details — SGN-E398765

Search information 
Request: 398765Match: SGN-E398765
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184966Clone name: TUS-46-C12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184966 is on microarray TOM1 spot ID 1-1-5.3.12.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17533 [cLED-19-P3] Trace: SGN-T53469 EST: SGN-E237555 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398765Length: 517 bp (804 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E398765 [] (trimmed) CAGCCTGCTTCTGCGCCTAACTGCATAATACACCGTTTTCGGCAGGAGAGCAATTCCCCCTACAAACAAAGTCATCATGCCTGCACTTGTTGTAA
CTGAAGAAACAATGGCCTCCGAGCTATCCAAGAAAAAAATGAAGAAGACACCCAAAACTGATATTGAAACTCCTACTGATAAGAAAACCAAAGAG
AAAAAGTCAAAAAAATCCAAGATTGAGTCTGGGTCTGATTCAGAGGACGCTAAAAGGAGTAAAAAAAAAAAAAAAAAAACTCGAGCTGCTTACCA
GCGAAAATCAACCTCTGCTGGTCTGAAGGAATTCCCTCCTTGTCCTGGATCTTAGCCTTAACATTATCAATGGTGTCGGAGCTTTCCACCTCCAA
AGTGATGGTCTTTCCGGTGAGGGTCTAAACAAAAATCTGCATACCACCACGGAGACGGAGGACAAGATGGAGGGAAGACTCCTTCTGAATGTTGT
AGTCAACCAGGGTGCAACCATCCTCGAAGGGGGGGCCCGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398765] SGN-U577265 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200091 [Download][View] Facility Assigned ID: FA0AAD34BB06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0157 Quality Trim Threshold: 12.5