EST details — SGN-E398795

Search information 
Request: 398795Match: SGN-E398795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183110Clone name: TUS-41-F4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183110 is on microarray TOM1 spot ID 1-1-5.2.3.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37392 [cLEG-41-O5] Trace: SGN-T72076 EST: SGN-E259044 Direction: 5' Facility: TIGR
Clone: SGN-C183110 [TUS-41-F4] Trace: SGN-T199498 EST: SGN-E398172 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398795Length: 507 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398795 [] (trimmed) GTGGAGAAGCCTAAAGAACCTGAGAAACCCAAAGTGGTGGTTGTAGAGAAGCCTAAAGAATCAGAGAAACCTAAAGTAGTATAGAAGCCTAAAGA
ACCCGAAAAACCTAAAATAGTGGCGGTGGAGAAGCCTAAAGAAGCTGAAAAGCCCAAAGAACCCGTGAAGCCCAAGGAACCAGAGAAGCCTAAAG
AGCCCGAAAAGCCAAAGGAGGTTCAGAAGCCCAAAGAGCCCGAAAAGCCAAAAGAAGCACCTAAACCAGCACCACCAGTAGCTCTTCCCCCACAA
CCACAACCACAACCACAACCACAATTTCCGCCAGTTCCAGAACCAGTGATCGTGATGCCAGTTCAAGGATATCCACACCAACCCTCTCCGGGGAT
GTATTGTTGTGGGCAATGTTACGAAGGCTATACTGGAGGCCCTTGTTATCATGATAATTGGTACGGAAGACCAGTACAACCACCTCCACCACCAC
CATGCTACGACACATATTCATACGGATATGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398795] SGN-U578859 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200121 [Download][View] Facility Assigned ID: FA0AAD29DC02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5