Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E398972

Search information 
Request: 398972Match: SGN-E398972
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172881Clone name: TUS-14-K23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172881 is on microarray TOM1 spot ID 1-1-2.3.20.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14204 [cLEC-7-D12] Trace: SGN-T25336 EST: SGN-E202054 Direction: 5' Facility: TIGR
Clone: SGN-C172881 [TUS-14-K23] Trace: SGN-T195139 EST: SGN-E393813 Direction: 5' Facility: INRA
Clone: SGN-C172881 [TUS-14-K23] Trace: SGN-T195758 EST: SGN-E394432 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398972Length: 701 bp (794 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398972 [] (trimmed) ACTACTCCAAACTAATTTTTCACAAGACAAGAGTTTAAATCCTGTGATACACTTTCTCGTTCAGTCTAGTGTTCCCATTTTCTATTCATCAGCGT
CTCGCCTGTCTGCTAAAACTTCTATCAATATTCAATTATCAAGAACCTGCCCCTAAAGGGACAAAACAAATACACTTACTAACTGGGAAGAAATA
GAGGGGAATCCTTCATTTACCTTTTGTGACTAGAAGTAGAAATCTAGAAGGCATTTAAGATAGTCTTCATGAGACCTTGAGTAACTCGTGGAATG
CCTCTTGGGGTATATCGACGGATCCCACTCGCTTCATTCGCTTCTTCCCTTCTTTCTGTTTCTCCAACAACTTCCTCTTTCTTGTAACATCACCA
CCATAACACTTTGCCAGAACATTTTTTCTCATAGCAGAAAGCGTCTCCCGGGCGATGACCTTAGATCCAATAGCAGCTTGTATGATAATTTCAAA
CGGGGGGCTGTCTATAAACTTTTTAAGCTTCTCAACAAGTTCGCGGCCGACACGTGGAGCTTTTGATTTGTGGACAATGGTTGCCATGGCATCAA
CTGGTTGGCCATTAAGGAGAATATCCAACTTCACCAAATCTGAAGCCTGATATTCTGAATCCTCATAATCAAACGAAGCATATCCTGATGTTATA
CTTTTTCATTCATTGTAAAAGTCCACAACAATTTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398972] SGN-U586459 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195758 [Download][View] Facility Assigned ID: FA0AAD2AF12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5