EST details — SGN-E399044

Search information 
Request: 399044Match: SGN-E399044
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172728Clone name: TUS-14-E14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172728 is on microarray TOM1 spot ID 1-1-3.1.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10861 [cLEC-6-H3] Trace: SGN-T24171 EST: SGN-E202510 Direction: 5' Facility: TIGR
Clone: SGN-C172728 [TUS-14-E14] Trace: SGN-T195223 EST: SGN-E393897 Direction: 3' Facility: INRA
Clone: SGN-C172728 [TUS-14-E14] Trace: SGN-T195782 EST: SGN-E394456 Direction: 3' Facility: INRA
Clone: SGN-C172728 [TUS-14-E14] Trace: SGN-T199551 EST: SGN-E398225 Direction: 5' Facility: INRA
Clone: SGN-C172728 [TUS-14-E14] Trace: SGN-T199598 EST: SGN-E398272 Direction: 5' Facility: INRA
Clone: SGN-C172728 [TUS-14-E14] Trace: SGN-T199598 EST: SGN-E399045 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399044Length: 334 bp (880 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399044 [] (trimmed) AAGTTTAAAGGTTCAGATGGACTTTTATGGAATCAGGACAGAATGTAACCACAATAACAGTACAATTCAGATTGACAGAAGAAATAGAACTATTT
TCTTCAAGTAAACCATGGACAAGACAGGTTTAGAAGTTGATATCATGTACAAACATTGAAGGGGTTATAATATTGTCCATGATCTGCTAAACCCT
TAGGGATCTGCTTTTCCAGCAAGTTCATCATCACTGGAAACATTTTCTTCTTCACTCAACTCTTCATCACTAAAATTTTCCTCCGGGGGAGCCCC
AAAGGACTTCCTTTCTTGGCGTATTTCTCCCAATACTCGTTCACCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399044] SGN-U562770 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195782 [Download][View] Facility Assigned ID: FA0AAD2BC07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5