EST details — SGN-E399194

Search information 
Request: 399194Match: SGN-E399194
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183679Clone name: TUS-42-M21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183679 is on microarray TOM1 spot ID 1-1-4.1.1.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2495 [cLEC-16-D24] Trace: SGN-T27088 EST: SGN-E205199 Direction: 5' Facility: TIGR
Clone: SGN-C183679 [TUS-42-M21] Trace: SGN-T194963 EST: SGN-E393637 Direction: 3' Facility: INRA
Clone: SGN-C183679 [TUS-42-M21] Trace: SGN-T194964 EST: SGN-E393638 Direction: 3' Facility: INRA
Clone: SGN-C183679 [TUS-42-M21] Trace: SGN-T194965 EST: SGN-E393639 Direction: 5' Facility: INRA
Clone: SGN-C183679 [TUS-42-M21] Trace: SGN-T199572 EST: SGN-E398246 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399194Length: 653 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399194 [] (trimmed) TCGGAGTATAGTGAGAAACTCCGGGAAGTGACAAGAAAGTTACTAGGAGGCATATCTGAAAGTTTAGGGCTTGAAGAAAGTTACTTGGAGAAAGA
TTTAGAGTTGGAATCAGGGCTTCAAATCTTCGTTGGAAATTACTATCCACCTTGTCCTCAACCTGAACTAGCAATGGGTATGCCACCTCATTCAG
ATCAAGGCCTTTTAACACTTCTCATTCATAACCAAGTTGGAGGTCTCCAGGTTCAACATCAAGGCAAATGGATTAACGTCAAGGCCCTTCCTAAC
TACTCTCTCTTGGTTAATACCGGCGATCATCTCGAGGTAATTAAATCCATTTTTCATGTCTACAGTCACAAAGACGCGTGATTTAAAATTAATCA
TCGGCCTTTTAAAGTATTGAGTTCATTGTTGCCAAGACTATTAATAGTAAGATTGAAATAGCAAGTTATTTTACTGTTACTTCAAGACCAAAATT
TTATTTAATATGGTAGATATTTAGTAATGGGAAGTACAAGAGCAACATGCATAGAGCAAGTGGTGAACAACAAAGTAACAAGGATATCAGTAGTG
GTAGCTCATGGTCCATCATTAGACACAATTGTAAAGCCCGCTTCTCCCTTGATGGAAAAAGAGAACAGCCCATCAGCTAATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399194] SGN-U580965 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199572 [Download][View] Facility Assigned ID: FA0AAD30AG11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5