EST details — SGN-E399536

Search information 
Request: 399536Match: SGN-E399536
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172670Clone name: TUS-14-C4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172670 is on microarray TOM1 spot ID 1-1-5.3.20.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10779 [cLEC-6-E11] Trace: SGN-T24076 EST: SGN-E202415 Direction: 5' Facility: TIGR
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T195209 EST: SGN-E393883 Direction: 3' Facility: INRA
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T195651 EST: SGN-E394325 Direction: 3' Facility: INRA
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T195652 EST: SGN-E394326 Direction: 5' Facility: INRA
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T200205 EST: SGN-E399024 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399536Length: 488 bp (885 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399536 [] (trimmed) AAGTGTAACAGTTGGCTTCCTTCATAATAGCAAAACATACATAATATCTTCAATTAATAAAGCAACCAAGGCCTCACAGACAAAGCCTCAGTAAC
AGTCACATATACATAAATTCAACAGAGGGGATAAAGGGAAGAACCTTGTTCAACACTACTCTTAGATGATCTAAAAAAGCAACAACATTATACTG
TTCATATATCTAATAAAACACTTCACTAATAATTTGAACAATCTTCGGAACCATAACTAATAAGAAATAGCCCAGAAACTATTGCATATATGCTT
CAACCATAGGATCACATATTTTTGGACTCATCATCTGATTCCTCAGAGGACACATCGGTATCTGTGTCAGTAGTTCCAATCACGGCTGCTGCTTC
TGAGTTTCTATTAGGGATCACCTCCGCCTCAGTGCTCTTCTTGCTTGATTGTTTTGCCTGTTCCATAAGCACTATCAAGAAGACGCAAAATGACT
TCGGGGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399536] SGN-U583559 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195651 [Download][View] Facility Assigned ID: FA0AAD2BB02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5