EST details — SGN-E399549

Search information 
Request: 399549Match: SGN-E399549
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172964Clone name: TUS-14-O10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172964 is on microarray TOM1 spot ID 1-1-7.3.20.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14379 [cLEC-7-L23] Trace: SGN-T25319 EST: SGN-E202037 Direction: 5' Facility: TIGR
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T1265 EST: SGN-E378743 Direction: 5' Facility: Giov. Lab
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195259 EST: SGN-E393933 Direction: 5' Facility: INRA
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195410 EST: SGN-E394084 Direction: 5' Facility: INRA
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195798 EST: SGN-E394472 Direction: 3' Facility: INRA
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195798 EST: SGN-E399103 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399549Length: 326 bp (914 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399549 [] (trimmed) AAGTTTTCATATTTAGTGATCACTAAAAAAAAATCAAGAAGATGTCGACTACTGTAGGCCAAGTCATTCGTTGCAAAGCTGCTGTGGCATGGGAA
GCTGGTAAGCCATTAGTGATGGAGGAAGTAGATGTTGCTCCTCCACAGAAAATGGAAGTTCGTCTTAAGATCCTCTATACTTCACTCTGTCATAC
TGATGTATACTTCTGGGAAGCTAAGGGTCAAAATCCAGTCTTTCCTCGAATTCTTGGACATGAAGCAGCAGGGATTGTGGAGAGTGGTGGTGAAG
AGGAAGTACAGACCTTGCACCAGGGAGACCATGTTCTTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399549] SGN-U579420 Tomato 200607 Build 2 345 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195259 [Download][View] Facility Assigned ID: FA0AAD2BH05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5