EST details — SGN-E399592

Search information 
Request: 399592Match: SGN-E399592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183503Clone name: TUS-42-F13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183503 is on microarray TOM1 spot ID 1-1-4.2.1.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34205 [cLEG-30-C1] Trace: SGN-T69005 EST: SGN-E255279 Direction: 5' Facility: TIGR
Clone: SGN-C183503 [TUS-42-F13] Trace: SGN-T200352 EST: SGN-E399364 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399592Length: 279 bp (959 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399592 [] (trimmed) GAAAACTACCTTTTTTCTTCAAATGAGTCCAACCCTTTTATGAATTACAATCTTTATTTTTTGCAATCAAGGGTCAAAAAGACCAAGTCTAAAGG
TATAAAACTACAAATGCCATTGTATGGCCATTTTTTCAACATAATGTACACTTGAAGAACACTCTGTGACTCCTCATTTCCATACAAAGACTTAT
TTCTGAAGAATGATAGCATGAAAACACAAGACACTTCAGATTTTGTCGTACCGACCCAAAGCCAGATCAATAAAAGTGCTTGAGGCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399592] SGN-U574459 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200471 [Download][View] Facility Assigned ID: FA0AAD30CC07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0139 Quality Trim Threshold: 14.5