EST details — SGN-E402274

Search information 
Request: 402274Match: SGN-E402274
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C266391Clone name: PPC-7-C2
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E402274Length: 562 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E402274 [] (trimmed) AAAAAAAACACCCTCTTTCTTTCCAAGAATTAAAATTATCTCACCCTCAAATCAATATTTATATTCCCTTTTTCAAACCTAGAGAATGAATAAGC
AAAAGGTTGTTATTAGGTTATCCATAAATGGTCATGATAAAAAATCAAGGTCCAAGGCTTTCAAAATTGCTGTTTCTCAGCCAGGTGTGAATTCA
GCAGCTATGATAGGGGGAGAAAATAACCAATTAGAAGTGGAGGGGGAGCAAATTGATGCAGCAGTGCTAACCAAATTGCTTAGGAAGAAATTGAA
GAAAGGAGCAGAGTTGTTAAGTGTTGGCCCTATTGACAAGAAAGATGGTGACAAAAAAGATGATCCAAAAATACAATTAGTTCCAATGATGCAAT
GGCCATCTAATAATTATTATCCATATCATGTTGTACCTCAATATCCATTTTATGAAGTTACAGAATCATATCAAGGTGGTTGCTCAATTTTATGA
AAGTAGTGTCGATTTATTGTCACCAATTCATGGAGTAATATATTGTTGGGTTTTAAAGGAGTGAATAGGAAATGAAGGGTTGTGATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E402274] SGN-U294581 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T259845 [Download] [View] Facility Assigned ID: PPCAZ13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5