EST details — SGN-E40381

Search information 
Request: 40381Match: SGN-E40381
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102676Clone name: cLHT-31-E2
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102676 [cLHT-31-E2] Trace: SGN-T171809 EST: SGN-E359423 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E40381Length: 621 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E40381 [] (called/trimmed by facility)
GGAACACTTTATTTGTTCAAAAGTCATTCCTATTAGACACAAAATGCTGACATAGCAAAAAACATGTAATTCACTTTCCTTGAGCGCGTTAATTT
ATTAAAAATAATATTTTTCTTTTTTTTTTTCTTAATTTATACCCCTAAGTTAATTTTTTAAAAAATAATTAACAAAAAAGAAGAAGAACAATTGT
ATTCTTCTTCCCTATTTCTATCAACCCCACCCCACCCCACCCCAACCCCCATACCCATGCACCAGTGGTTATCTTCTTCCCCCACCATTCTAATG
ATTTCAAAATTCTTAGCATCAGTGGTTATCTTCTTCCCCCTCCAACATCACCATTGTAACAAAGAATTGGAATCGAATTCCAAAACCAAGCAAAG
AGAGCAATGGCTGCTTCCACACAATGTTTCTTGCACCAATATCATGCACTAAGATCTAGCCCTGCTAGAACCTCCTCTGTTTCATCTCCTAAGCC
TAACCAATTGATTTGCCGTGCACAAAAGCAAGATGATGCCAGCAACGCCGTGTCGAGACGATTGGCTCTTACTCTCCTCATTGGTACTGCTGCCA
TTGGTTCCAAGGTTTCCCCTGCAGATGCTGCCTATGGAGAAGCTGCAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T171809 [Download] [View] Facility Assigned ID: THTER25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence