Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E405336

Search information 
Request: 405336Match: SGN-E405336
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C264637Clone name: PPC-17-N16
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E405336Length: 599 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E405336 [] (trimmed) GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AAGTACGAGACTCTATCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAAGGAAGTTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTT
GGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACAACAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCA
TGTTTGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGGAGGAGGCAAAGAAGGCTTACCCACAGGCATGGATCCGTATCATCGGATTCGAC
AACGTTCGTCAAGTGCAGTGCATCAGTTTCATTGCTTACAAGCCCGAAGGATACTAAAATGCCAAGTTTTAATTAATGTAATGTATAACTGACCC
TATGTATTTAGGGGAAGCTTGTTTGAATCCTCCTTAAGTTTTTCCCTGGAGAAACTGTATTAATTTTACGTTGTTGTTTCCCTTCATCTTTCGAA
AAANAAAAAAAAAAAAAAAAANNAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E405336] SGN-U290748 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T262907 [Download] [View] Facility Assigned ID: PPCCP80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0104 Quality Trim Threshold: 12.5