Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E406651

Search information 
Request: 406651Match: SGN-E406651
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C260784Clone name: PPI-4-D7
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E406651Length: 494 bp (913 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E406651 [] (trimmed) GTCACAAGGATTGTCTTCAAATCCTACCGGCTGAAGGGTACTCTGACTCCTGCCATTGGGAGGCTTGCTGAGCTGAAAGAACTGTCCCTACAAAA
CAACAAACTCTTTGACAGAGTACCAACTGAAATCGTTGACTCGAGGAAATTGGAAATCTTGAACCTTCAAAACAACCAAGTGTCTGGCAAAGTCC
CACCTGAATTATCATCGCTAGTCCGACTTCGTACCCTTGACCTTGGCTCTAATGAGTTATCTGGGAACCTGAACTTCTTGAACTACTGTCCTAAC
CTTGAAAAACTCTACCTTGCTGATAACATGTTGACTGGCGGAATGCCTCAATCCTTGAAATCTTTCAGAAATCTCCGGCTCCTCAACATTGCAGG
CGATAGTTTCCTTGAAGGTACGGTGCCTGTCCTGAGTCACGTTGAGCACTCATCAGCAGACTTAGATCGAAAAGATTATGTTCCTAAGCGTTACA
TTCTTGCTGAGAACGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E406651] SGN-U289356 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T253726 [Download] [View] Facility Assigned ID: PPIAO16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0277 Quality Trim Threshold: 14.5