Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E406881

Search information 
Request: 406881Match: SGN-E406881
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C261085Clone name: PPI-5-E10
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E406881Length: 676 bp (872 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E406881 [] (trimmed) CCACACTTCAGTTCCCAGAGAATGTGGTGAATTTTAGATTGAAGAGTGATACTGATCTCTTTGAAATTGTGAAATGCAAAACTGCTGTTTCTTCT
ATAGAGGTAAGCCCTGATGGTAAACAGTTCTCGGTAACTTCACCAGATCGCAGGATTCGTATATTTTGGTTCAAGACAGGTAAACTAAGACGTGT
GTATGATGAATCTCTTGAGGTGGCACATGATCTCCAGAGGAGTGATGTTCCTTTATACCGACTTGAAGCAATTGACTTTGGACGAAGAATGGCTG
CGGAAAAAGAAATTGAGAAAACAGAATATGTACCACAACCTAATGCTGTTTTTGATGAAAGTTCCAACTTCATTATATATGCAACTCTCCTAGGA
ATTAAAGTTATAAATCTACACACCAACAAGGTATCTCGTATCCTGGGGAAGGTGGAGAGCAATGATAGATTTTTGAGAATTGCTTTGTATCAAGG
TGATAGAAGTAGTAAAAAAGTAAGAAACATCCCTGCTGCGGCAGCTAATGCAAATGAAAGCAAGGAGCCCTTGATAGATCCCACTCTACTTTGCT
GTGCTTTCAAGAAACATAGAATCTATTTGTTCAGTCAGAGAGAACCTGATGAACCTGATGATCCTACCAAGGGAAGAGATGTCTTCAATGAAAAG
CCACCTCCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E406881] SGN-U291984 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T253956 [Download] [View] Facility Assigned ID: PPIAR29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5