EST details — SGN-E409661

Search information 
Request: 409661Match: SGN-E409661
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C258860Clone name: PPI-14-P23
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E409661Length: 401 bp (888 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E409661 [] (trimmed) TGAGAACCTTGCTGCCGGTAGTGGTGACTTCATGACGGCCACGAAAGCTGTGGAGATGTGGGTCGATGAGAAACAATACTATCACCATGACTCCA
ATACATGTGATGAAGGACAAGTGTGCGGACATTATACTCAGGTGGTTTGGCGTAATTCTGTTCGTCTTGGATGTGCTAGGGTTCAATGTAATAAT
GGAGGATACGTAGTATCATGTAACTATGATCCTCCAGGTAATTTTATAGGCCAAACTCCATACTGAAAAGCGACTTATTACTTAATGATTACATA
TATATTTGTGCTCCTATGTGAGGTACGAACGTAGTTCAATATTAAAAGTAAAAGAATAATGTACAAGTTGTAACAATTATGAAGCTGCTTCTATA
TATATAANAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E409661] SGN-U291879 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T256736 [Download] [View] Facility Assigned ID: PPICC96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0051 Quality Trim Threshold: 12.5