Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E411197

Search information 
Request: 411197Match: SGN-E411197
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267432Clone name: STM-14-C22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E411197Length: 522 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E411197 [] (trimmed) GCAATGTTCATGTATGTTTACAGGATTTTCATTTCTCTTTTGCTGATTTTGGTCCATTGTGAGGTGACTGTTGAACAGGTTACGCACGGCCCTCT
ACGCAAAATCTGTACATTTACTAGGCGTGATAAAACTATAGCAGAAATACCTCCTCTTGCCAGAGAAGATGAGGATGTCATCACTGAGCTGCTTC
GGTGTAATTCAAGAGTATTACCGCCAAGGTGTTTGATAACTGGAAGTAATTCCAAAGTTATTTGCAATTGTACTGTTGAGAATTGTCGAGTGGTG
GAGATAGATTTCTCCGATAGACGAATAGAAGGTGGGATCCCTCAGAACATTGGAAACCTTAAATATTTGACTACTCTTAATTTGGATAGAAACAA
GTTGAATGGACCAATTCCTGAATCATTTAAAGATCTGACGCAACTAACGCACATTTCTCTCTGTGATAATTCATTAAACGGAACCATTCCACTTT
CCCTTGGTGAGATGAAGTCTTTACAAAAAATATCTTTGTGCAAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E411197] SGN-U293152 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T263334 [Download] [View] Facility Assigned ID: STMCB23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5