Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E41172

Search information 
Request: 41172Match: SGN-E41172
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15549Clone name: cLED-13-E13
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175590 is on microarray TOM1: SGN-S1-1-5.4.13.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15549 [cLED-13-E13] Trace: SGN-T51617 EST: SGN-E236339 Direction: 5' Facility: TIGR
Clone: SGN-C175590 [TUS-21-L20] Trace: SGN-T190745 EST: SGN-E378131 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E41172Length: 436 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E41172 [] (called/trimmed by facility)
GCACCAGGCAAGGTCTTTTAAAGTTGGAAGAATAGTCCATGCGAGAAAATTCTTTGCTGAGATGCTATCTGCAGGGTTCATACCTGATTTTTACA
CTCATGGCATTGTGATCAATGGTTATTTTAAGAATGGACTTGTTGAAGAGGCTTTGTCGCTCTTTAATAAGTTGGAAGGAAACAGAGAAATTAAT
GATATTGAATTTTACAATGTTGTCATCAATGGATTGTGCAAAACTGGTGAACTCGATGAAGCTCGTGCTATTTTTGAGAAGCTTTATTTAATTGG
ATTGCTTCCGAATGCGAGAACATACAATAAGATCACTAATGGATTTTGTCTTGAAGGGTTGTTAGATGAAGCTAATGATATGCTTAGAAAAATGG
AGGAGAATGGTATTTTGCCAAACTTCTTCACTTACAATGCCCTTGTGCGGGGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T51617 [Download] [View] Facility Assigned ID: TOVBW31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence