EST details — SGN-E412284

Search information 
Request: 412284Match: SGN-E412284
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268172Clone name: STM-16-E3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E412284Length: 672 bp (937 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E412284 [] (trimmed) CTCTTAGCAGCTTTCGCAGTTGCTCTCAGGCTCAGCTCCCCTTACAACCCACCTCTTTCCCTCCTCAATTCTTCAAAAAGTCCCAATTCTTGAGA
CTACAGAAATCAAACTCAGCACAGTGTTATCCACGCTTGGTGATTGCGAAGGCGTTGGGGACGGGCGATAATGGTGACTTTGAAGATTTTACAGC
TACACCTAACAAGATTTTTATGGAAGAGGCAATTGGTGCCGAATACGGAGAAGGTTTCGAGACATTTAGACCCAATGGACTGCTCAAAGTTGATG
TGGATTTTTTAAATGATAGACTGCAAGAGGGTTTCCTGCGAAGAATCCGTTATGCGATGAAGCCTGATGAAGCTTATGGCCTCATTTTCTCTTGG
GATAATGTGGTGGCAGATTCTCGAGCTCTGAAGTTGGATGCCTGGAATCAACTTGCCTCTGAAGAAGGATTAGAGCTTCCTGAAGATGATAGTGT
GCAGCGGCTGTTACTTAATGCAACTGCTGATCATGTTCTGCATAAGGCGCTGCCAAAGGAGAAGAATGAAGCTGATCAGGATCGATTGAAGATGA
GGCTTTCCCAACTCTATCATGACAAGCTTCTGAAAATTTCAGAGCCAATTGAAGGGTTGAAAGAATGGCTGGATGCCGTATCAACTGCTCGTATC
CCTTGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E412284] SGN-U289045 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T264421 [Download] [View] Facility Assigned ID: STMCI26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5