Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E412566

Search information 
Request: 412566Match: SGN-E412566
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268112Clone name: STM-16-B9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268112 [STM-16-B9] Trace: SGN-T264702 EST: SGN-E412565 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E412566Length: 520 bp (949 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E412566 [] (trimmed) TCTTTTTTTTTTTACAACGAACACGAGTTTTTTTCATATTCAATCAAAACTCTGTATCCCCATTTCTCCATACATACTAAAACAATGGGCTCAAA
CAAGTTCCAGTATATCAGATGAACATAATCATATTGGGAATTTTTCATTATTCCCACTTACAATGCAAGGTTCACTTAGCTTTACAAAATGATAA
GCCTGATGACAAATAGGTAACATGGATAAACCACAGGATCTTGTGTTTCATTGGGTTCTTGCAATCTTGTTCAAGCTTGAATATGAAAATCACAT
AAGCAGGCTAGCTAGTGGGCTCTAATGTCGCTTGTTCATGCCAAACTCCGTTCAAGTTGCACTGCCACAAGCGAACTACACCATCGCTTCCAGTA
GTAGCAAGTGTCATCCCACTCATGTCCCATTCCATCTGCCATACCTCACTGTCATGAGTAGAGAGCATTGCAACCTTCTCCACCGAGAGCCTTCC
ATCAGAGTCTGGATTTGATCCAACATGCCATAATGGAATTTCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E412566] SGN-U292900 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T264703 [Download] [View] Facility Assigned ID: STMCK05TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5