EST details — SGN-E412664

Search information 
Request: 412664Match: SGN-E412664
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268311Clone name: STM-16-L1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268311 [STM-16-L1] Trace: SGN-T264800 EST: SGN-E412663 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E412664Length: 442 bp (962 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E412664 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAAATCAATTATGTCAAATAACTTTATGAACTGCACTAAAGGGGGTTTATCTTCAT
ATTTATTTACTAATGATGAAGATGAATATAAATTTGGCTTCCAAGTTATTGACCATAATAACATGGGGAAATAGCTTGTATAAAAAAATATATAT
TTTGACATTTGCATTTTCTTAGTATAAATTATATATGCAAACGATACTTAGGAATCAACCTAAGATGTTGAACTCTAGTTGTTACTAAACCAAAT
TTCTCAGTCATGTCAATATCCTTCGGGGTAATGCCATTTGGCGATTCCCAATCAAAGCAATGAACCAATTGTGCGAGCACCAAACGAACGGGGGT
GAGCCCTAGCTGCAAACCCGGGCAACTTCTTCTGCCCGAACCAAATGGTAAAAGCTCAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E412664] SGN-U296520 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T264801 [Download] [View] Facility Assigned ID: STMCK61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5