EST details — SGN-E413074
| Search information |
| Request: 413074 | Match: SGN-E413074 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C268507 | Clone name: STM-17-E12 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C268507 [STM-17-E12] | Trace: SGN-T265210 | EST: SGN-E413073 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E413074 | Length: 209 bp (945 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E413074 [] (trimmed)
TATTCATCAACTTTCTTAGATTTTCTTTTTTTTATCTAACTACTGACCCATTGAAACCCCAATTACATTCTGAAACTTATAAGTTAGACAATATA
AACATTATAATCCCCTCTAATAGCCCTAGAACTATACGTCGAATCGTCCCTTCGAAGACTATGGATTCCATACACGATGCAACAACACGAACGAT
GCGACTATGACGATATTAT
AACATTATAATCCCCTCTAATAGCCCTAGAACTATACGTCGAATCGTCCCTTCGAAGACTATGGATTCCATACACGATGCAACAACACGAACGAT
GCGACTATGACGATATTAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E413074] | SGN-U273080 | Solanum tuberosum | Build 4 | 9 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T265211 [Download] [View] | Facility Assigned ID: STMCN30TV |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.925 | Expected Error Rate: 0.0050 | Quality Trim Threshold: 20.5 |
Working
