Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E415007

Search information 
Request: 415007Match: SGN-E415007
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269565Clone name: STM-20-F19
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269565 [STM-20-F19] Trace: SGN-T267143 EST: SGN-E415006 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E415007Length: 688 bp (909 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E415007 [] (trimmed) AAACTTTTTTATCAAAGGAGATATAGTTTCTTTATAAATCATGTTGTATTGTATTGAGAAATACATATCATCATCAGAAAACTGTACAAGGGGAT
ATTCCTGGACAGGCCTTTTGTCACTATTGGTGTGCAGGCCACTGTAATAGAATCAAAAAATCAAACAAAGAAAAAAAAAGATCTCTTTTTACATA
CAGCAGCTGGTCTGGTCCAGGATACTAATATAAGTTAATGAAATTAGAACTGAATTTACAATTGTCTTCTTCAGTCCGCAGTCCTTTTGTTCCAG
TATATATGTTCTTCAGTCAGCAGTCCTTTTGTTCCAGTATATATGTTCTTCAGTCAGCAGTCTTTTGTTCCAGTAAATATGTATTAACAAGACTG
TACAGAAATGTTCAGCATACAATTTTCTGTTGTCATTCAGCGAATACCACGGTTCAGGTGAGCGAATGGTTCAGGATTTGCCTTTGGTGCAGGTT
TTGCTACTTCAGGAGTCCCAAATACATTCCAGAATCTGAGAGTTTCATCTCCAGCTGCAGATGCAACTGTGCAACCATCTGGACTCTGAGCCATG
AAAAGTACTCTGGATGTGTGGCCAGTTAGCTCAGCTACCTTTACCATAGAAGGGTATTTCCAAAGGGTAAGCTGATTCTGAGTGAAACCATGAGA
ACTTAGCAGCTCACGTTCGTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E415007] SGN-U289942 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267144 [Download] [View] Facility Assigned ID: STMDA34TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5