Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E417259

Search information 
Request: 417259Match: SGN-E417259
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271231Clone name: STM-25-I9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271231 [STM-25-I9] Trace: SGN-T269395 EST: SGN-E417258 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417259Length: 572 bp (916 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E417259 [] (trimmed) TCTTTTTTTTTTTTTTTTTTTCCGAGGAATAAAGTGAACTTTTATTTACAAGGAACTGTGTTTTTTCCTTACATTAAATGTTCCTTACAAAGGAA
CCTCTTCCACTTTCCCCATTATATTACATGATGAATAGGAGATGTTAATGAGAATTAAATAACATCTCCAACTGTACATTTTGTGACATAATGAA
AGAATAATTAACTCAAACAAAATTGCATCTTTTCTTGCCGCTCCATCAAACAAAAAAATGTGATGTGTATTTCTTGATGGAATAATTTCTACGAG
TGGAAAATAATTACAATTCGTCACCTGATCTGAGTTCTACCAAACGAAGATGCACCAATTTCAGTCTCGGTGTTCTTTGACTTGGGAGAAGGGAA
AACATTCCAAAATCGAAGTGTTTCATCTCCTGCTCCAGTGACAATTGTCTGTCCATCTGGAGATATAGCAAGATATAAGACTCTATATGTATGAC
CTGTCAGAGTAGCTATCTTAGACATTGTCGGATATCTCCAAACTATTATCTGGTTTTGAGAGTAACCATGTGTGCTGACTAATTCATTGACATTC
TT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417259] SGN-U291734 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269396 [Download] [View] Facility Assigned ID: STMDS53TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5