Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E418544

Search information 
Request: 418544Match: SGN-E418544
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271748Clone name: STM-27-D22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271748 [STM-27-D22] Trace: SGN-T270680 EST: SGN-E418543 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418544Length: 806 bp (877 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E418544 [] (trimmed) TTTTTTTTTTGTTCTATATGTCCTTTTTAACACAAATGAATCCTGCATTTACATCTCAAAACTCTATTATACACAAATGGAAAAAGCCAGTTCTT
TATGGACTAGAGAGTTGGCAAACCAGCATCAGGTATCTCATTGTAGTTTTCCTCTAAATATGACTCTGTTCTTCATCTTCTATCCAACAGAAGAA
TGGGAAATTGTACGTTAGCACCAGGCAACACTCATCATACTGAGCTCTGTCGTAGAGGTTCAGCTTCATGATGGACAACCTGATTCTGATTGTGG
TTGTCGAGAGGCATGTATTGTGACATGATGGCCATAATCTCCGAGTCCATGTATGACCGAAGTCTATACTTGTAAAAGGTGTAACCAGCTAAACC
AGCCCCCACTGCAATGGCTAGGAAAGAGAACATAAGGACCCGTCCAATCTTTGATGAGTGTCTTTCTATACAAGTATCATGCTCCATTATGTACA
GTTGATTTCCTTTGCACTTACACTCGAATCCTCCCCACGTGTCCTTACAGCTACAGCCATCACACTGACAAACACTTCCTTCCTTGCATTCATCT
ACATCTTCACATTTATGGCCATCCCCTTTAAAACCATACGGACACTTACAGCCTGATAGTTCACCCTCTGAACATGCTGAATATGTTTGCCCATT
TCTGGTTTCTGACCAGCATCCTCCATTGTTTACCGTACACCTTCCAGGTCCAATGGCTTCACAAGATGTGTATCCATCTCCTTTATACTGAACGC
CATTCACCAAAGGGCACTCACAAACTCTTCCCTCTAATGTATCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418544] SGN-U292072 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270681 [Download] [View] Facility Assigned ID: STMED23TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5