EST details — SGN-E418593

Search information 
Request: 418593Match: SGN-E418593
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271859Clone name: STM-27-J18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271859 [STM-27-J18] Trace: SGN-T270731 EST: SGN-E418594 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418593Length: 450 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E418593 [] (trimmed) GACGAACCTTGTTAGCTATTTTCCGTTAAGTTGGTCACATTGTTCGCAGGAGATCGGACGAATTTCTGCCGTCCGATCTCAGTTCAGTTACAGAT
CCGAATCTCCATTTCCTACAAGGCTGCTTGAGCTCAAAATTAAACTGCTATGGGATCTGATGGTCAAAATTGGTATTTGGGTTTAACCTATGACC
AATGGGTTCCTCTGTCTGTCTCTGGTCCGACACCAGCTGCTCGCTACAAGCATGCAGCTGTCACAGTTGATGGGAAATTATATATCATCGGTGGA
AGTCGTAATGGACGATACCTGTCTGACATTCAGGTCTTTGATCTAAAATGTTTGACATGGTCAACCATAAAGTTGAACTCTGGAGTTCTTCCAGC
TACCTCTGGCCACAATATGATCTTGTGGGAAAATAAACTTCTATTTCTTGCTGGTCACTCAAAGGATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418593] SGN-U271577 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270730 [Download] [View] Facility Assigned ID: STMED57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5