EST details — SGN-E419592

Search information 
Request: 419592Match: SGN-E419592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272501Clone name: STM-29-L2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C272501 [STM-29-L2] Trace: SGN-T271728 EST: SGN-E419591 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419592Length: 520 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E419592 [] (trimmed) TTTTTTTTTTTTTTTTAGAGGAAAAATAAACATTACTAGTATTCAATCTTAAGTAAAAGCACACATACACTATGAAATTACTAAACATAGCAAGA
AACTGAAAAAAGTGACGATTTTGAATTACTAGTATTCAAGCTCTACCCTCGTTAGCTAACTTGAATAGCTGTGCCTGAGCTGCAGCTGACTTGTC
TGAACTAAGTGCTGAAACAAAACTATCCCTGACTTGGTTGGAAGTGTAGGTGAAGCTTTTGCTCACCATGGAGTTCAATAATGAAGCTGTTCCTT
CTCTGTAGAGATCGCCGTAGGCATCGGTACGAGAGTTGGAAAGTGCTTGGAGCAAGTTCATGCTTGATCCGAAACCTGGAACACTAGCCACACCA
AATGAATTTCCTACAGTTCCCCACCAGCCAAATAAGCCCCATATAAGTGTTGGGTGAGTCCTCCAGTAATTGCATGTAAAAGGTGGTGAGTTGGG
GTCTACTGGGAAGACACCTGGAGCACTTGGAGTTCCGGGATCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419592] SGN-U274656 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271729 [Download] [View] Facility Assigned ID: STMEL61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5