EST details — SGN-E419774

Search information 
Request: 419774Match: SGN-E419774
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272927Clone name: STM-30-O5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419774Length: 502 bp (956 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E419774 [] (trimmed) ATCAATGGCTTCATTAGGGNGGAAAGAGTACATANCACCTTTTACTTCACACGGTTTTAAAAACTATATTCAGAACAATGACAACAAAACTCGAT
AAAATGAAAAGGTTATCTAGGGTCACACAAGAATCAAACTCCACTACAACAAAAAGTCTATCATGTTACATACCTTGGGTACCGCCTTCTAGGTG
AGGTGCATCCACTCAGACATTCAGCCTGGAAGCTGCATGGTGGAAGATCGTTTTTACAGTCCACAGCATCAGTTGTTGTGTCAGCAGTACTTTAA
GGTGCCTATCACATCTAATATATGAAAACATAGATATCAAGAAACCTTCTCATTTGGTGACGGAAATGGTTCCGATTCAACTGATGCAGGTGGAT
CCAAATTCATTTGATCTGTTGGAGGTGGTACAGATTTAGCTTCATCAGCTCCGTCTTGAGCAGAGTCCATAGGATCTTTCAATGGTGTAGAAGGC
TCAACATGATCAGTTGATTGTACTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419774] SGN-U298973 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271911 [Download] [View] Facility Assigned ID: STMEM87TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0206 Quality Trim Threshold: 14.5