EST details — SGN-E420230

Search information 
Request: 420230Match: SGN-E420230
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272856Clone name: STM-30-L24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C272856 [STM-30-L24] Trace: SGN-T272366 EST: SGN-E420229 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E420230Length: 422 bp (944 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E420230 [] (trimmed) ATTTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTTTTTTTTTTTTTTTTTAGGGACACATACAAACTTTTTCCTAATAAACTAAACAAGTTATCGT
TACAAAGCCTCTTTTGAGGACTTGAGCACAATTGGATATTGCAAAAACCAGTAAAGGGGAAGGGGAAAAAAAAGGCAAAAAATAAGCTGAAATGG
AAATTCCTACTCAACGTATTAGCGTACTATATGTTCTTTACAACATCGACCTGATATCCAAACAACAACGGAAAGGAAACACAGTTCGATTCCAG
ATGAATCAACACGACTTTACACCACACAACCCATAAAACTAATACCATTCTCATATAAAGGACTCCAAGCTACATGTCAATTGCTCGAACCTACT
CATTTGTTTATGCCTCGGCTACCCAAATCAGCTGCAGCTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E420230] SGN-U292363 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T272367 [Download] [View] Facility Assigned ID: STMEP72TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0209 Quality Trim Threshold: 14.5