EST details — SGN-E420921

Search information 
Request: 420921Match: SGN-E420921
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273303Clone name: STM-31-P16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273303 [STM-31-P16] Trace: SGN-T273057 EST: SGN-E420920 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E420921Length: 768 bp (856 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E420921 [] (trimmed) TTTTTTTTTTTATCTTAAAAGCATAACATATTAAAACCGTTTCAGCAGCTCATCTTGGAATTCGCTATAAAAAAAACCAGACAGGAGAAAGACAT
CCAAAGGTGCTATTGTCACTGCCCATCAAGCAACTTGGATCAAACCAAATTGCTCAACAACTCCACTATCCTCAAACGAGGCTAGAGAACCATGA
CAAAAGCTTCTGGAGCCGTGTCTATGACTGGTAAAACGTTCATAACAAAATTGAAAATAGCTAATGCAATTAAACAAAACTAGTTCATCAATGCA
GAATCTCATCAAAAACACATCACTTCTTCTTTTGGGCAGCCTTGGTGACTTTGGCACCAGTAGGGTCTTTCTTGTCGACGTTCTTGACGACACCA
ACAGCGACAGTTTGACGCATGTCCCTCACAGCAAAACGTCCCAATGGTGGGTACTCAGCGAAGGTCTCAACAACCATGGGCTTGGTGGGAATCAT
CTTAACCATACCGGCATCACCATTCTTCAAAAACTTGGGCTCCTTCTCAAGTTCCTTACCAGAACGTCTGTCAATCTTGGTCAAGATCTCAGCAA
ACTTGACAGCAATGTGGGAGGTGTGGCAGTCGAGCACTGGGGCATATCCGTTTCCAATCTGACCAGGGTGGTTCATGATGATAACTTGGGCAGTG
AAGCTGGCAGCACCCTTTGCTGGGTCATCTTTGGAGTTCGAGGCAACAAAACCTCTCTTAAGATCCTTAACTGCAACGTTCTTGACATTGAACCC
AACATTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E420921] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273058 [Download] [View] Facility Assigned ID: STMET92TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5