EST details — SGN-E421436

Search information 
Request: 421436Match: SGN-E421436
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273560Clone name: STM-32-L2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273560 [STM-32-L2] Trace: SGN-T273572 EST: SGN-E421435 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421436Length: 255 bp (830 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E421436 [] (trimmed) ACAATTTTTTTTTTGCTCAGAACAAAAAAAAATGTTCTATTGCATAAGTAGCTCAAATTCGAAACTTAAGTTAATCCCAAGACTCATAATCAACC
AAAAGCAGAACATAATACTTCAAAAACTACGACGTAATCTAACAAAGTTAAATTTTTTACTCACTCCAGTACTTCTCTTCACCATCTTTATGATC
TTTTTGATTGTCATCATCTTCAAATCCTTTAGCCAAACTCATCTTAAACTTCTTCACATCCTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421436] SGN-U284390 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273573 [Download] [View] Facility Assigned ID: STMEX61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.889 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5