Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E421650

Search information 
Request: 421650Match: SGN-E421650
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273669Clone name: STM-33-A6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421650Length: 591 bp (967 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E421650 [] (trimmed) GAAGAGTTTCGCATGGGAAATGAGGTTCGTGGTCTGCCTTGTGCTCACAACTTTCACGTGGAATGCATTGATGAATGGCTTCGCCTAAACGTGAA
ATGCCCTAGATGCCGCTCTTCTGTCTTTCCAAATCTTGATCTCAGTGCTTTATCCAATATCCGAACCGATTCAGAGGGGTCAACAGCCAATGTTG
TGACAGCAGCACAGTATGTGAGATCCCAACCCTCCAGCCAGAGCTATCTGCTAAGAATGCAAGGTTTGCTCCGCCCTGTACCCACACAGGATACT
GGCCTGGGCAGTGAGGTAGATCCTGCTGATATCAGCAACCAAGCATCCACACCTCATAGTCATGGAAACGTGGAACCTGTACAAGTTGTAGTGGA
ACAGTCTCCGAGGGAGCAATAACCATACTTCCAGAGGAGGTTCTTTACCTTTTCAAATTTCTAACTTGGTGATTCCTAACAACCTGTAGTCATTG
TCCAGTGTTCGTAGTGGTTTCTCATTGCAACCAAAATTCATCAATTGGAAATGTGGGTGGCATGATTTATGTTCACAGCCAGCTTGTTCAGATGG
AGCAATATATGTTTGTTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421650] SGN-U284962 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273787 [Download] [View] Facility Assigned ID: STMEZ03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0153 Quality Trim Threshold: 12.5