EST details — SGN-E421651
Search information |
Request: 421651 | Match: SGN-E421651 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C273669 | Clone name: STM-33-A6 |
| ||
Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C273669 [STM-33-A6] | Trace: SGN-T273787 | EST: SGN-E421650 | Direction: 5' | Facility: TIGR |
Sequence |
Sequence Id: SGN-E421651 | Length: 139 bp (801 bp untrimmed) |
Status: Contaminants not assessed | Direction: 3' [See links to 5' reads above] |
>SGN-E421651 [] (trimmed - flagged)
ATAACTACTTTAGTATTAACAAGTAGCAACAGATACAGTTTTACTGATGGGAAACTCAGTCTTGAAGGTTCATTTAGACACAGAATAAACAGTAT
GTGAATTAATCGATAAAACTCGTGGTAAAACAAACATATATTGC
GTGAATTAATCGATAAAACTCGTGGTAAAACAAACATATATTGC
Unigenes |
Current Unigene builds | |||||
No current unigene builds incorporate this sequence |
Chromatogram |
SGN-ID: SGN-T273788 [Download] [View] | Facility Assigned ID: STMEZ03TV |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Problems: | Too short after trimming low-quality bases |
Sequence Entropy: 0.891 | Expected Error Rate: 0.0043 | Quality Trim Threshold: 20.5 |