EST details — SGN-E421651
| Search information |
| Request: 421651 | Match: SGN-E421651 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C273669 | Clone name: STM-33-A6 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C273669 [STM-33-A6] | Trace: SGN-T273787 | EST: SGN-E421650 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E421651 | Length: 139 bp (801 bp untrimmed) |
| Status: Contaminants not assessed | Direction: 3' [See links to 5' reads above] |
>SGN-E421651 [] (trimmed - flagged)
ATAACTACTTTAGTATTAACAAGTAGCAACAGATACAGTTTTACTGATGGGAAACTCAGTCTTGAAGGTTCATTTAGACACAGAATAAACAGTAT
GTGAATTAATCGATAAAACTCGTGGTAAAACAAACATATATTGC
GTGAATTAATCGATAAAACTCGTGGTAAAACAAACATATATTGC
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T273788 [Download] [View] | Facility Assigned ID: STMEZ03TV |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Too short after trimming low-quality bases |
| Sequence Entropy: 0.891 | Expected Error Rate: 0.0043 | Quality Trim Threshold: 20.5 |
Working
