EST details — SGN-E421651

Search information 
Request: 421651Match: SGN-E421651
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273669Clone name: STM-33-A6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273669 [STM-33-A6] Trace: SGN-T273787 EST: SGN-E421650 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421651Length: 139 bp (801 bp untrimmed)
Status: Contaminants not assessed Direction: 3' [See links to 5' reads above]
>SGN-E421651 [] (trimmed - flagged) ATAACTACTTTAGTATTAACAAGTAGCAACAGATACAGTTTTACTGATGGGAAACTCAGTCTTGAAGGTTCATTTAGACACAGAATAAACAGTAT
GTGAATTAATCGATAAAACTCGTGGTAAAACAAACATATATTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T273788 [Download] [View] Facility Assigned ID: STMEZ03TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: Too short after trimming low-quality bases
Sequence Entropy: 0.891 Expected Error Rate: 0.0043 Quality Trim Threshold: 20.5