EST details — SGN-E421663

Search information 
Request: 421663Match: SGN-E421663
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273663Clone name: STM-33-A20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273663 [STM-33-A20] Trace: SGN-T273799 EST: SGN-E421662 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421663Length: 669 bp (960 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E421663 [] (trimmed) TTTCTTTTTTTGGAAAAATGTCAAATATATTTTCTGAGAGGAAGGGTTAACTATATTTTGTTAGACTGCAAGCTTGGAAAGAAATTGTTTCAAAC
AAGTTAACTAGTGTTCTCTGTTTTTCATCTAATATCTAACGGGGTGTCATCCGTTGTACTATGTGCAAATTGGCTAGAATGTAATTCAGTATCTG
ATGCATCTCCTTCCATGTAAAAAGCTGGTAGTTTAGCCTGAGGCAGCGTACCTTCATTGTTTAACATTAGAACTACGGAAGACATACTTGGACGA
TCATCTGGACGTTCTTGGACACATAATAGACCAACACCAATTGATCGTACCACTTCTTGAGGTGTAGAACAAGAATCACCTACGCGTTCATCAAG
TAGTTCTATTGACCTCCCTTCCTTGTTGAGTTCCCATGCATGCCCGATTAGACTACGGTTAAGGTTTGAAGGAGCGAATCGTCTGTTGCTTTTTC
CACTCACAATTTCCAGTACTAAGATACCAAAGCTATACACATCTGATTTTACAGAGTATTGCCCATATAGCGCATATTCTGGTGAGAGGTACCCG
TATGTTCCAATAACTCGGTTTGTCATGGCTTCATTACCATCCTCTTCATGGCATCTTGCTATACCAAAGTCTGATATCTTTGCATTCATATCATT
GTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421663] SGN-U296972 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273800 [Download] [View] Facility Assigned ID: STMEZ10TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0137 Quality Trim Threshold: 14.5