EST details — SGN-E422805

Search information 
Request: 422805Match: SGN-E422805
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274436Clone name: STM-41-C21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274436 [STM-41-C21] Trace: SGN-T274941 EST: SGN-E422804 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422805Length: 375 bp (1124 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E422805 [] (trimmed) TTTCATATGTATAACTTTAACATACCTAGAATACTTAATATGTGAAGACCAAATATAACCACTTAGATTATTTGGAATACATCAAATTCAAGGGC
ATTTAGACTTGCCCTTAGAGTTCTTCTTGTCCCTATAACAAGGACATTCATGTTTGTTACCATAAGTTCCAGAAGGCACACATTTGCATTCTTCA
CAACAAATTCCACAGTACTTTAAGCATCTGTCTGCAAGTCCTGCCTTTGAACATCTCAGCTTGCACTTTGAATCACAAAAATTTGAACCAGCCAT
GGTAGTTTGAATGAGAGAAGGGGTAATAACAAGAGTGACCAAAAGCAGAGTTAATAGAAATAACTTCATTTTTTCTAAGCTGAAAATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422805] SGN-U270467 Solanum tuberosum Build 4 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274942 [Download] [View] Facility Assigned ID: STMGE23TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5