EST details — SGN-E423889

Search information 
Request: 423889Match: SGN-E423889
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275094Clone name: STM-42-P23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275094 [STM-42-P23] Trace: SGN-T276025 EST: SGN-E423888 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423889Length: 747 bp (914 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E423889 [] (trimmed) TTTTTTTTTTTTTGAGCAAAAAAGGTTTATTACCAGAAAAGAAATAGGGGGAATCCAGCAATACAGTTGTAGTTATAGACTATGCTAAGGTGTCT
GTAGCTGCTCTAGTGTCTTGAAAGAAGCCTCATTCATACCGTTTTCACAACAGATTGCACCTAATAATGACTGCCACACATGGATATCTGGAGTC
AAGGCTAGAGAGATCATGTCCTCCAAACACATAATTGCACTGTGTAAATCACCTACTTGGCAGAGACCTCGGATAAGAGAATTCAAAGTTCCAAC
TCTAGGCCAAAAGGAATTAATTGACATTTGCTCCATCACCTTGCTTGCTTCAACATATTTACCATCTTCACATAACCCATCTACCAAAGTTTCAT
AAGTTTCATAGTTTGGCACGCAACCTACTTGCCTAGACATCCTTTCCAAATACTTAATAGCACAAGTAGATTTTCTTTCATGGCATAGGCCTTTT
ATAACTACATTATACAATCTAATATTCGGAACACAGTTTTTTTGCACCATCTCACAATCAATGACCATAATTGCCTCGTCAACCTGGCCATCCCT
GAAAAGAGCAGCTACCTTTGCTTCATAAATCACCACTGACGGTTTGAAGCCTCTGTCATGCATTTCCTTGAGCACTTTGTTACCTTCATCAATCT
TGCCTTCGGCATAAAAGTCAACAGACATTGCTCTGTAGCTATCTGAACTGGGAACTATGCCTTTTATCAAAGCTTCATTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423889] SGN-U298167 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T276026 [Download] [View] Facility Assigned ID: STMGK96TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0023 Quality Trim Threshold: 20.5