EST details — SGN-E424673

Search information 
Request: 424673Match: SGN-E424673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275399Clone name: STM-43-N14
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275399 [STM-43-N14] Trace: SGN-T276809 EST: SGN-E424672 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E424673Length: 570 bp (896 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E424673 [] (trimmed) TTCTTTTTCTTTTCTACTGCCGAATTTTCATACATCATCAGGGCGATGGTATATTTACAACTGATAATGTTGCCATGAAAGTCCCCATATCTACC
CAGGGGCTTGAGAAATATAAGTAACATACATCTCTTCACTCTTCAGATACTCTTATTTCTGCAGTGCAGCATACCGTCTCAATGGTGTGATCTGT
AGAGGAGGATGGTGTTGAACCGTACAAAATTCCTAAACAACTGTTGGCGTTTTACGCTTAATGTGCCGAGATGTCAACTCTGACTCCGTCCCTCC
AAGCATTTCCCACATCACCTGTACATCTTCATATCCACAGGACTGTATATCGCCTTGAAGCTTCAATAATCCAGCACCATCTTTACGAGGCTTGA
CACGAGCAGAAACAGCACCCCAAACACGTCTAACCGGAAAGACCATTTTTTGCCACAAATCCTCCATCTCCTCTCCTCTACTCCTATGTTTGGTT
GAAAATGAAAGGGTTTATAGTGCTCTTTGTTGCAATAAAGAATGTAATGACTAGAGACTAATAAAGGAGTGATGTGTTCCTTCCACTCTTGAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E424673] SGN-U281574 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T276810 [Download] [View] Facility Assigned ID: STMGP79TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5