EST details — SGN-E426168

Search information 
Request: 426168Match: SGN-E426168
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276419Clone name: STM-46-K13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276419 [STM-46-K13] Trace: SGN-T278304 EST: SGN-E426167 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426168Length: 800 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E426168 [] (trimmed) CACACTTTTTTGGCAATAATTAGTTTTTTCTTCTAACGTTCCGATATTAACTTTGCTACATGGTGGCAATCTGTACATATTCTAAGGTTTTTCAC
TATCCTAATAGTGAATCCAGGTTCAGAATTGATTAGAGCAAATGCAATCGCCAACTTCTCACTGTGTCGACTAAGGGAGTTCTCTTTCTCATCTT
CTCCTATGTCAAGAGAAACCTCTGAAGTATCTGGAACATAACCGGAATATTTTAATTCTCCAATCAACTCAGCCAACTTTGAATATATGCTTTTA
GATTGAGGATGAGACTGATCCCCTGCAACGAATTCATGAACAATTCCATGCATCTCTATCAGACTACAACCTGGTGTCTTCTTGATCCCGCGATC
TGTCATTATTCTTCTTGTTTCGCGCAAGTTATCCCATTTTTTGCAAGCTGCATATATATTACACAAGAGAACATAGACAGCCCCGTTTCCAGGCT
CTAGCTGAAGAAGTTGTTGAGCTGCAATTTCAGCCATTTGAACATCCTTGTGAATTCTGCAAGCACCAAGAAGAGCTCCCCAAACAATTGGATTT
GGTTTCACTGGCATACTCTTTATAACTTCATAAGCTCCCTCCAAATGCCCTGCTCGACCAAGAAGATCAACCAGACAGCCATAATGTATAACATT
AGGTTGAATGCCATGCTGAGAGGCCATGTTTGCGAAGAAGCTTTTTCCTTCGTCTACCATACCCATATGAGTACAAGCACTAAGAACACCAATGT
AAGTCACATCATCCGGTGTTTCTGAAGCTCTCAGCATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426168] SGN-U293047 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278305 [Download] [View] Facility Assigned ID: STMGY67TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5