EST details — SGN-E426451

Search information 
Request: 426451Match: SGN-E426451
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276360Clone name: STM-46-H19
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276360 [STM-46-H19] Trace: SGN-T278587 EST: SGN-E426450 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426451Length: 735 bp (937 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E426451 [] (trimmed) CAAAAACTTTTTTTTTTTTTTTTTTTTTTATACACTAATATAGGTTTCTATCACAAATGAATATTGTAAAGGAAGACAATTACAACAATAGAGAT
GGATAACTGCATTGAAACAGGACCAAACTCTCAAACTGTGCATAATCAAGTGTATCGAAAAAAGTTTCAGGACATGTGAAGTTACTCCTGGCGCC
AACTCTTCTTGCAACACTATCAAGGGGATCCATAATACAAAACAGGATATCCAGGAAAGCAACATCAAACATTCCCTTGGCAGATATCACCTCTA
CATAATGGGCATACCCTGTGAACTTCTTTGAGCCATTTGTCAACACAAGTCCTGTGAAATTCATGATGGCAAGGCAGTGTTCGTAACATATCTCC
TTCCTCGTACTCAACCAGACAAATGTAACATTGTGCAACTTCGTCATTCGAACTCCTACGAAATTTGTTGTATGATTTGACAGGTAGGGATTCAA
CAACTTCATTGGGTGCTGGAACAGATCCAATTGAGGATACAGAAGGCTGGGATGATAATACAACTGATTGCTGATGAATTTCATCCAGAACCTAA
AATGAGTATCCAAGTTCAACTTGTACTGATGATTAAAAGGTAGATGTTGATGAAGTAAAACGGATTGGTAACATTACCTCGAATAAAGCTTCTGC
CAGCATAACAATTCTTGAGATGCTTGCCCTGGCACTACTGTCACTATCTAAGTTAGCTCCTTGGTTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426451] SGN-U284627 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278588 [Download] [View] Facility Assigned ID: STMHA46TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5