EST details — SGN-E426705

Search information 
Request: 426705Match: SGN-E426705
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276622Clone name: STM-47-E11
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276622 [STM-47-E11] Trace: SGN-T278840 EST: SGN-E426703 Direction: 5' Facility: TIGR
Clone: SGN-C276622 [STM-47-E11] Trace: SGN-T278841 EST: SGN-E426704 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426705Length: 777 bp (938 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E426705 [] (trimmed) TTCTTTTTTTAATAAGACTATAATTTTCTTTTCTTTTGCCTGTGTAGCACAATAGATGCAGCAAATTCGTTGACATCGTATGAGCGGATCAATAA
ATTGTTGAAACTAAAAAATAAAATAAAATAAAATAAAAATTCATGTTTATACTAAAACTTCGACGCATCCTTTGCAAATTTTAACAAGAAACTCA
AAATTGAAGTCTTGAGATCTTCGTTTGTCACACCAGTTTTTGTTTCGAAAACACCCTTCATGATGCGAGTGTATAATCTTTCTAGCTGAGGAATG
CCGTAGTCCTTTGTGTGCTTTACGAATTGCTTCTTCACGGACTCGATTTTACGGGACATTTCTGCATCTGACATTGTAACATCTCGGCATGCGTC
TCCAGTTGCATCTGGCACGTCTGCGGGTTTATTCCCGTCAGCAAGAGTGCTTTCTGGCCTTTGCTCTGAAGCATCTCCTTCATGGTCATTAGATG
ACTTGGAAGGCAATGAATCCTGAGGTTGTAATTCATCATCTAGCACCAATTGTGCAGAATCAGCATGTTTCTTGTGCCTTCTCAGTGCTTCAAAG
CTCTGATCTAAGTTGACTTCAGGCTGGACATTACGAAGGCGGGCTCTTGCTCTAGTCAAAGTAGCCGACTGTAAGACGGGATTTTGTGGCAATGC
ATCTCCACCTAATTCGTCANGAACTGACACTGGACCCCCTTCAGTAGCAATCTTCTCACAGAAAGCAACTAAGGCAGGATCCATTTGGGAAAGCA
TTCCATATACTGAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426705] SGN-U296535 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278842 [Download] [View] Facility Assigned ID: STMHC30TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5