EST details — SGN-E426852

Search information 
Request: 426852Match: SGN-E426852
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276593Clone name: STM-47-C22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276593 [STM-47-C22] Trace: SGN-T278987 EST: SGN-E426850 Direction: 5' Facility: TIGR
Clone: SGN-C276593 [STM-47-C22] Trace: SGN-T278988 EST: SGN-E426851 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426852Length: 779 bp (910 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E426852 [] (trimmed) NNTAACTNTTTTTAAAAGAAAATGAAATTTGCTATTTTAGTTTAGTTGGCATCTTTGACCACTTGACTCAAACATCCAAAGTAAAATAATTTTAC
AATTCAAGTGATTGTTTTGCACAAGAAAACCAAAAGTAGCTAGAGTAACTTTAGTTTCATTTCTGCTGCTCAATTTGAACTGACAAGCTTAGGCT
TCCACAATTTCCAAACCAACAACTTGTTTTCTCTTGGTGTGTGTTCTACCAACCTTCTACTTGCATTGAGACACCTTATCATAAACATGTCATCG
TCGACGTTTGGCGTTGAACTTTCGTCTACAGGGGTTCGTGGACATTTAGCTCCTTCAGTTGCCTCCACAACCTGATTTACCATCTCCAAGACCTC
GCTCATTTTTGGACGATTTCTCGGGTGTTTAACTAAACACCTATTAGCTATGGCAGCTAACTTCTGAGCAGATTTAATGGAATAGTTTCCATCCA
ATCGAGGATCCAATATTTGTTCAAACTTCTTCAGGTCAGAAAGATGTGGTCTTACCCATTCAAGAAGTTTCTGCTCATTTTTAGGTTTATTTCTG
TCCAACGGACGCCTGCCTGTGATGAGTTCATATAGAAACACCCCATAGCTCCATACATCACTCTTGGACGTTAGGCGCCCAGTTTGTATATATTC
TGGAGCAGCATATCCAACAGTTCCCACCACCGCTGTTGAGACATGGCTTAATCCGTCAGAAGGTCCTAATCTGGCCAAGCCAAAATCAGACAACT
TTGCATTCCATTTCTCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426852] SGN-U293533 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278989 [Download] [View] Facility Assigned ID: STMHD23TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5